Skip to main content

Advertisement

Table 1 Real-Time PCR Assay-by-Design Primers and Probes for MUTYH Y165C, G382D and S501F

From: Genetic variants in MUTYH are not associated with endometrial cancer risk

SNP Forward Reverse Wild Type Probe Mutant Probe
MUTYH S501 (C>T) CAGCCTTCCAAAAGGTTCCCA GCTGTGTGCATCAGTGGAGAT VIC-CACGGAG AGGACAC FAM-CACGGAA AGGACAC
MUTYH Y165C (A>G) CCACAGGAAGGTGAATCAACTCT CCTTACCTTCCGAGCTCCCT VIC-CTGGGCTA CTATTCT FAM-GGGCTG CTATTCT
MUTYH G382D (G>A) GACCCCTGCCTGGCT GACGGGAACTCCCACAGT VIC-CCTCTCAGG TCTGCTG FAM-CCTCTCAGA TCTGCTG
  1. Note: The mutation/polymorphism is underlined in the probe sequences.
  2. * The MUTYH S501F polymorphism is designed on the reverse strand.