Skip to main content

Advertisement

Table 1 Primers used for the analysis of exon 15 of the APC gene

From: Germline Missense Changes in the APC Gene and Their Relationship to Disease

Segment Sequence Oven Temperature (°C)
FAPex15.1For gttactgcatacacattgtgac 50,59
FAPex15.1Rev gctttttgtttcctaacatgaag  
FAPex15.2For agtacaaggatgccaatattatg 50,59
FAPex15.2Rev acttctatctttttcagaacgag  
FAPex15.3For atttgaatactacagtgttaccc 50,54,60
FAPex15.3Rev cttgtattctaatttggcataagg  
FAPex15.4For ctgcccatacacattcaaacac 50,55,57
FAPex15.4Rev tgtttgggtcttgcccatctt  
FAPex15.5For agtcttaaatattcagatgagcag 50,52
FAPex15.5Rev gtttctcttcattatattttatgcta  
FAPex15.6For aagcctaccaattatagtgaacg 50,59
FAPex15.6Rev agctgatgacaaagatgataatg  
FAPex15.7For aagaaacaatacagacttattgtg 50,54,59
FAPex15.7Rev atgagtggggtctcctgaac  
FAPex15.8For atctccctccaaaagtggtgc 50,60
FAPex15.8Rev tccatctggagtactttccgtg  
FAPex15.9aFor agtaaatgctgcagttcagagg 50,58
FAPex15.9aRev catcatcatctgaatcatcta  
FAPex15.9bFor accaagagaaagaggcag 50,54,59
FAPex15.9bRev ccgtggcatatcatccccc  
FAPex15.10For gcccagactgcttcaaaattacc 50, 61
FAPex15.10Rev gagcctcatctgtacttctgc  
FAPex15.11For ccctccaaatgagttagctgc 50,54,60
FAPex15.11Rev ttgtggtataggttttactggtg  
FAPex15.12For acccaacaaaaatcagttagatg 50,57
FAPex15.12Rev gtggctggtaactttagcctc  
FAPex15.13For atgatgttgacctttccaggg 50,58
FAPex15.13Rev gctcagtctctttgataggttc  
FAPex15.14For ctgagttctctcagtgacattgac 50,58
FAPex15.14Rev gttctgaatctggtctctg  
FAPex15.15For tatgggtggcatattaggtg 50,59
FAPex15.15Rev cctttactttcagattctatc  
FAPex15.16For aggcccacgaattctaaaacc 50,54,58
FAPex15.16Rev cctggcaacagggcttaattc  
FAPex15.17For gaaggtcaaacagccacc 50,59
FAPex15.17Rev ggcattcttggataaacctg  
FAPex15.18For catctccaggtagacagatgag 50,59
FAPex15.18Rev cttaaaactggagtttgtgcctg  
FAPex15.19For ctccatcatctagaccagc 50,61
FAPex15.19Rev cactggattctgatgaagc  
FAPex15.20For tggagaagaactggaagttc 50,58
FAPex15.20Rev gggagatcttccagatctagg  
FAPex15.21For acagaggatgtttgggtgag 50,60
FAPex15.21Rev gcttgagctgctagaactg  
FAPex15.22For cctgtatcagagactaatg 50,55,60
FAPex15.22Rev caaaatgtctatatagcagttg