Skip to main content

Table 1 Primers used for amplification

From: Germline MUTYH gene mutations are not frequently found in unselected patients with papillary breast carcinoma

Variant Forward primer (5' - 3') Reverse primer (5' - 3') Product
p.Y179C CCCCCTAGCTCCTCTACCAC CGGGTGATCTCTTTGACCTC 202 bp
p.G396D and p.P405L AGCCCAACGCTGTAGTTCCT GAGGGCAGTGGCATGAGTAA 182 bp
  1. Bp = Base pair.