Skip to main content

Table 1 PCR primers and annealing temperature for each of the 16 exons

From: Sequence-based detection of mutations in cadherin 1 to determine the prevalence of germline mutations in patients with invasive lobular carcinoma of the breast

Coding region Forward sequence Reverse sequence Annealing temperature
Exon 1 ggtgcctccggggctca gaatgcgtccctcgcaagt 70.5°C
Exon 2 gagtcacccggttccatctacctt ccagggacaccggcagc 70.5°C
Exon 3 tcttgtctttaatctgtccaatttcctaatctc gcgcactaaaacaacagcga 63.5°C
Exon 4 tatccgtcttgaattgtcttatcttgttcctcatc ccctcccagagaaacagagaactt 63.5°C
Exon 5 cagtgttgggatccttctttactaattc cccggtgtcaacaagcttctaa 63.5°C
Exon 6 tttcttcctcatcagagctcaagt tccaaagaacctaagagtctttctgagta 69.0°C
Exon 7 tcccaaagtgcagcttgtctaa taatacacatttgtcctccacaccc 60.5°C
Exon 8 gtcctgacttggttgtgtcg agacctttctttggaaaccctctaa 69.0°C
Exon 9 agtcttggtactttgtaaatgacacatct agctgtgaggatgccagtt 69.0°C
Exon 10 aaatgtttcgttttgtttttaacttcattgt ccagttgctgcaagtcagttga 67.5°C
Exon 11 tttcagctacatgttgtttgctggtcctatt gctaggaggtcgaggcagcaaag 60.5°C
Exon 12 ttgccaagctgccacattt gcatggcagttggagcaaag 63.5°C
Exon 13 cctcccctggtctcatcatttc aagtcaaaggctgagtcacttgc 67.5°C
Exon 14 cttctttatctttggctctcaacactt agagatcaccactgagctacc 63.5°C
Exon 15 cctactcttcattgtacttcaacct tgagcttagagatgagccatgc 63.5°C
Exon 16.1 acaggtgtgcccttcctttcactaa ccaccagcaacgtgatttctgcattt 60.5°C
  1. Cycling conditions were: 95.0°C for two minutes, followed by 50 cycles of 94.0°C for 30 seconds and the specified annealing temperature for 30 seconds, followed by a single cycle of 94.0°C for 30 seconds and then 20.0°C for 30 seconds.