Skip to main content

Table 3 The sequences of the primers used in the nested-PCR reaction

From: Comparison of whole genome amplification and nested-PCR methods for preimplantation genetic diagnosis for BRCA1 gene mutation on unfertilized oocytes–a pilot study

Mutation Sequence of the primers mp Product length
5382insC F: 5’ AGTGATCTGCCTGCCTCAGT 3’ 64,1°C 315 pz
R: 5’ CCATCTCTGCAAAGGGGAGT 3’ 65,4°C
185delAG F: 5’ TTGGAGAAAGCTAAGGCTACCA 3’ 65,4°C 685 pz
R: 5’ CCCAGTGCAGAACCAATCA 3’ 64,9°C
C61G F: 5’ TTGCTTATGCAGCATCCAAA 3’ 64,2°C 633 pz
  R: 5’ GCACTCCAGCCTCAGTGAC 3’ 63,9°C