Skip to main content

Table 1 The sequences of the primers used in the ASA-PCR reaction

From: Comparison of whole genome amplification and nested-PCR methods for preimplantation genetic diagnosis for BRCA1 gene mutation on unfertilized oocytes–a pilot study

Mutation Sequence of the primers mp Product length
5382insC N: 5’ AGAGAATCCCAGGACA 3’ 68,2°C 168 pz
M: 5’ AGAGAACTCCCAGGAC 3’ 81,8°C
R: 5’ ATATGACGTGTCTGCTCCAC 3’ 64,1°C
185delAG N: 5’ GCTGACTTACCAGATGGGACTCTC 3’ 66,1°C 335 pz
M: 5’ CCCAAATTAATACACTCTTGTCGTGACTTACCAGATGGGACAGTA 3’ 78,4°C
  R: 5’ GGT TGG CAG CAA TAT GTG AA 3’ 63,4°C